HML document specification

This document serves as a guide for understanding the HML document structure, as an alternative to having to read through the DTD itself. For each element of the DTD, a description is given for that element, its attributes, and its child elements.

Element: hml

Description:
hml is the root element of the document.

Attributes:
Name Type Required? Description
version CDATA Yes The version of HML that this document should conform to.

Children:
project 1 or more

Element: project

Description:
The project element groups data into sections with a common destination or purpose, which is denoted by the "name" attribute.

Attributes:
Name Type Required? Description
name CDATA Yes Identifier for data's intent. (ex: "STAR", "SG09")

Children: (in order)
reporting-center 1
sample 1 or more
typing-test-names 0 or more

Element: reporting-center

Description:
The reporting-center element specifies the origin of the data as a center code.

Attributes:
Name Type Required? Description
code CDATA Yes Reporting center code identifier

Children: none

Element: sample

Description:
A "sample" element encloses the typing data pertaining to a particular sample. It may contain multiple hla-typing elements. One for each locus, for instance.

Attributes:
Name Type Required? Description
id CDATA Yes Identifier for the sample
center-code CDATA Yes Center code of the sample's origin (donor center, transplant center, etc.

Children:
hla-typing 1 or more

Element: hla-typing

Description:
The hla-typing element encapsulates a typing call combined with other primary data that may have been used to determine that call (sso, ssp, and/or sbt elements).
Contains:

  1. at most one interpretation element
  2. as many sso, ssp, and/or sbt elements as needed
These may appear in any order, but at least one child must be present.

Attributes:
Name Type Required? Description

Children: (at least one)
interpretation 0 or 1
sso 0 or more
ssp 0 or more
sbt 0 or more

Element: interpretation

Description:
interpretation element specifies the typing call at allele/code level. Usually contains one or two haploid elements for a particular locus, but may contain more if multiple loci are covered (example: two DRB1 haploids + one DRB3 haploid). As an alternative, it may contain one or more allele lists to represent the type(s).

Attributes:
Name Type Required? Description
date CDATA Yes Date on which the typing was carried out, or on which the final call was determined. Required to be in "YYYYMMDD" format (ex: "20030101")

Children:
haploid 1 or more, or
allele-list 1 or more

Element: haploid

Description:
A haploid element specifies one-half of a full typing at a particular locus.

Attributes:
Name Type Required? Description
locus CDATA Yes Locus (ex: "A", "DRB1")
method CDATA Yes Typing method used (ex: "DNA", "SEROLOGY")
type CDATA Yes Allele/code level type (ex: "0101", "01AB")

Children: none

Element: allele-list

Description:
An allele list is a representation of the list of possibilities for a type.

Attributes:
Name Type Required? Description

Children:
allele 1 or more

Element: allele

Description:
An allele element is simply the designation for a single allele.

Attributes:
Name Type Required? Description
source CDATA Yes Identifier (namespace) for the name attribute. This can be thought of as the HLA sequence database release version (ex: "HLADB-2.0.0")
name CDATA Yes Identifier for the allele (The allele name) (ex: "A*010101")

Children: none

Element: sso

Description:
Specifies an SSO test that was done. Scores are required, along with a reference for resolving what SSO probes correspond to the list of scores. Only one of "ref-id", "probe-name", or "nmdp-refid" may be given.

Attributes:
Name Type Required? Description
ref-id IDREF No Internal XML reference to a typing-test-names element contained in this document.
nmdp-refid CDATA No ID of kit registered with NMDP. The cardinal sequence numbers of the registered probes in the kit will determine the score order.
probe-name CDATA No Fully qualified probe name. (ex: "L999.K1.V1.A9F-S11") If this attribute is used, the scores attribute must contain exactly one score.
scores CDATA Yes The results of the SSO test, specified as one string (ex: "118111100181")

Children: none

Element: ssp

Description:
Specifies an SSP test that was done. Scores are required, along with a reference for resolving what SSPs correspond to the list of scores. Only one of "ref-id", "name", or "nmdp-refid" may be given.

Attributes:
Name Type Required? Description
ref-id IDREF No Internal XML reference to a typing-test-names element contained in this document.
nmdp-refid CDATA No ID of kit registered with NMDP. The cardinal sequence numbers of the registered SSPs in the kit will determine the score order.
name CDATA No Fully qualified SSP name. (ex: "L999.K1.V1.SSP12345") If this attribute is used, the scores attribute must contain exactly one score.
scores CDATA Yes The results of the SSP test, specified as one string (ex: "118111100181")

Children: none

Element: sbt

Description:
Specifies an SBT test that was done. The result of the test (the DNA sequence) is given in the child "sequence" element.

Attributes:
Name Type Required? Description
name CDATA Yes Fully qualified name of the SBT test (ex: "L999.K1.V1.SBT54321")
score CDATA Yes Result of primer amplification used for this test. This is usually '8', but may be '1' in which case no amplification happened and no sequence is likely to have been obtained.

Children:
sequence 1

Element: sequence

Description:
The sequence element contains the DNA sequence obtained from an SBT test. Primary (A, C, G, T) and wildcard nucleotides (M, R, W, S, Y, K, V, H, D, B, X, N) may be used (ex: "<sequence>CCGGAGTATTGGGACCAGGAGACACGGAATATGAAGGCCCAC</sequence>")

Attributes:
Name Type Required? Description

Children:
PCDATA

Element: typing-test-names

Description:
The typing-test-names element specifies a list of test names internally referenced by an sso element or an ssp element. It wraps a list of "typing-test-name" elements.

Attributes:
Name Type Required? Description
ref-id ID Yes XML ID reference unique in this document.

Children:
typing-test-name 1 or more

Element: typing-test-name

Description:
A typing-test-name element specifies a test name contained in a referenced "typing-test-names" list.

Attributes:
Name Type Required? Description
name CDATA Yes Fully qualified test name (ex: "L999.K1.V1.A9F-S11", "L999.K1.V1.SSP12345")

Children: none